Другие статьи

Цель нашей работы - изучение аминокислотного и минерального состава травы чертополоха поникшего
2010

Слово «этика» произошло от греческого «ethos», что в переводе означает обычай, нрав. Нравы и обычаи наших предков и составляли их нравственность, общепринятые нормы поведения.
2010

Артериальная гипертензия (АГ) является важнейшей медико-социальной проблемой. У 30% взрослого населения развитых стран мира определяется повышенный уровень артериального давления (АД) и у 12-15 % - наблюдается стойкая артериальная гипертензия
2010

Целью нашего исследования явилось определение эффективности применения препарата «Гинолакт» для лечения ВД у беременных.
2010

Целью нашего исследования явилось изучение эффективности и безопасности препарата лазолван 30мг у амбулаторных больных с ХОБЛ.
2010

Деформирующий остеоартроз (ДОА) в настоящее время является наиболее распространенным дегенеративно-дистрофическим заболеванием суставов, которым страдают не менее 20% населения земного шара.
2010

Целью работы явилась оценка анальгетической эффективности препарата Кетанов (кеторолак трометамин), у хирургических больных в послеоперационном периоде и возможности уменьшения использования наркотических анальгетиков.
2010

Для более объективного подтверждения мембранно-стабилизирующего влияния карбамезапина и ламиктала нами оценивались перекисная и механическая стойкости эритроцитов у больных эпилепсией
2010

Нами было проведено клинико-нейропсихологическое обследование 250 больных с ХИСФ (работающих в фосфорном производстве Каратау-Жамбылской биогеохимической провинции)
2010


C использованием разработанных алгоритмов и моделей был произведен анализ ситуации в системе здравоохранения биогеохимической провинции. Рассчитаны интегрированные показатели здоровья
2010

Специфические особенности Каратау-Жамбылской биогеохимической провинции связаны с производством фосфорных минеральных удобрений.
2010

Молекулярно-генетическая идентификация saccharomyces cerevisiae az- 12

Saccharomyces cerevisiae на сегодня самый известный и широко используемый организм в производстве различных продуктов питания, включая хлеб, различные алкогольные напитки, в том числе вино, пиво и ряд ферментированных напитков. Saccharomyces cerevisiae var. boulardii имеет близкие морфологические и биохимические характеристики [1]. Среди отличительных особенностей очевидным различием между ними является необычно высокий оптимальный рост Saccharomyces cerevisiae var. boulardii соответствующий температуре 37 ° C, которая очень близка к температуре тела человека. А также другой важной особенностью является более высокая выживаемость при низком кислотном значении рН [2].

Из различного растительного сырья, произрастающего в Туркестанской области, выделено 180 различных видов дрожжей, большинство относятся Saccharomyces 159 и только 21 культуры к Dipodascaceae, чистых культур выделено 71.

Культурально-морфологические свойства Saccharomyces cerevisiae–Az- 12 (из гранатового сока): Колонии на солодовом сусле-агаре небольшие, гладкие, выпуклые, с ровными краями. Средний размер клеток составляет 5,0 × 6,4 мкм. Форма клеток в основном округлая. Размножается почкованием.

Физиолого-биохимические свойства. Сбраживает: глюкозу, фруктозу, сахарозу, мальтозу, мальтотриозу, не использует галактозу, в небольшом количестве потребляет пентозы — арабинозу, ксилозу и рибозу, в качестве источника углерода могут использовать многие простые соединения глицерин, в результате сбраживания сахаров образует CO2 и этиловый спирт.

Особенности роста: Температурный оптимум 37±1°С. Клетки растут в пределах от 5°С до 45°С. Оптимальное значение pH среды 3,5-5,5. Сохраняет жизнеспособность в диапазоне pH от 1,2 до 10. Растет при содержании желчи в среде до 3,0%.

Saccharomyces cerevisiae Az- 12 является устойчивым к гентамицину, оксациллину, цефазо- лину, амоксиклаву, тетрациклину, норфлоксацину, ванкомицину, эритромицину, цефотаксиму, ципрофлоксацину, цефуроксиму, метронидазолу, кетоназолу, амфотерицину. Проявляют выраженные антагонистические свойства по отношению к Е. coli.

Молекулярно-генетическую идентификацию микроорганизмов проводили методом секвенирования по Сенгеру. Геномную ДНК из 1 суточных культур выделяли с помощью набора для выделения ДНК из растений/грибов «Plant/Fungi DNA Isolation Kit» компании Norgen Biotek Corp. (Канада) согласно протоколу4 производителя. Концентрацию ДНК в образцах определяли с помощью флуориметра Qubit (Invitrogen, США) по шкале для dsDNA HS.

В работе использовались универсальные праймеры ITS-региона дрожжей: ITS1 (5,- TCCGTAGGTGAACCTGCGG-3,) и ITS 2 (5,-TCCTCCGCTTATTGATATGC-3,). Реакционная смесь для амплификации состояла из: 12,5 мкл Q5® Hot Start High-Fidelity 2X Master Mix, 1,25 мкл Forward праймер (10 мкМ), 1,25 мкл Reverse праймер (10 мкМ), 1,5 мкл ДНК и 8,5 воды. Общий объем ПЦР - смеси составлял 25 мкл. ПЦР c универсальными праймерами проводили на амплификаторе Eppendorf при режиме амплификации: 94ºС – 30 сек; 55ºС – 1 мин; 72ºС – 40 сек – всего 30 циклов; 72ºС – 10 мин. Продукты ПЦР окрашивали и вносили в 1,2% агарозный гель. Визуализировали в УФ- трансиллюминаторе.

Реакцию секвенирования проводили с применением BigDye Terminator v3.1 Cycle Sequencing Kit (Applide Biosystems) согласно инструкции производителя [BigDye® Terminator v3.1 Cycle Sequencing Kit Protocol Applied Biosystems США], с последующим разделением фрагментов на автоматическом генетическом анализаторе 3500 DNA Analyzer (Applide Biosystems). Результаты секвенирования обрабатывали в программе SeqА (Applide Biosystems). Полученные нуклеотидные последовательности ITS-региона ДНК грибов были подвергнуты сравнению с данными базы Gene Bank (www.ncbi.nih.gov), с помощью программы BLAST. Филогенетический анализ проводили с использованием программного обеспечения MEGA6. Выравнивание нуклеотидных последовательностей проводили, используя алгоритм ClustalW. Для построения филогенетических деревьев использовали метод «объединения соседей» Neiighbor-Joining (NJ). В результате амплификации с IТS- праймерами получен ПЦР-продукт размером около 550 bp.

Результаты анализа последовательностей ITS гена у изучаемых штаммов представлены в виде филогенетических деревьев, построенных в программе MEGA 6, с использованием Neiighbor-Joining кластерного метода расчета генетических расстояний.

Последовательность нуклеотидов:

TTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCA GCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAAC GGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGG AGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAAC ACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTT AAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAA TGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCC CCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAG

Степень гомологии со штаммом MH608341.1 Saccharomyces cerevisiae isolate extr03 составила 100%.

Таким образом, существует потребность в ценных молекулярно генетических исследованиях, способных различать штаммы и устанавливать соответствующие методы идентификации пробиотических штаммов S. cerevisiae var. boulardii, при этом очень важный шаг – это найти функциональную связь между конкретной ДНК и пробиотическим действием.

Использованная литература:

  1. H. Kumura, Y. Tanoue, M. Tsukahara, T. Tanaka, K. Shimazaki, Screening of dairy yeast strains for probiotic applications, J. Dairy Sci. 87 (2004) 4050–4056.
  2. McFarland LV. Systematic review and meta-analysis of Saccharomyces boulardii in adult patients. World journal of gastroenterology: WJG. 2010;16(18):2202-22. Epub 2010/05/12.
  • Теги: США
  • Год: 2018
  • Город: Шымкент
  • Категория: Медицина

Разделы знаний

Архитектура

Научные статьи по Архитектуре

Биология

Научные статьи по биологии 

Военное дело

Научные статьи по военному делу

Востоковедение

Научные статьи по востоковедению

География

Научные статьи по географии

Журналистика

Научные статьи по журналистике

Инженерное дело

Научные статьи по инженерному делу

Информатика

Научные статьи по информатике

История

Научные статьи по истории, историографии, источниковедению, международным отношениям и пр.

Культурология

Научные статьи по культурологии

Литература

Литература. Литературоведение. Анализ произведений русской, казахской и зарубежной литературы. В данном разделе вы можете найти анализ рассказов Мухтара Ауэзова, описание творческой деятельности Уильяма Шекспира, анализ взглядов исследователей детского фольклора.  

Математика

Научные статьи о математике

Медицина

Научные статьи о медицине Казахстана

Международные отношения

Научные статьи посвященные международным отношениям

Педагогика

Научные статьи по педагогике, воспитанию, образованию

Политика

Научные статьи посвященные политике

Политология

Научные статьи по дисциплине Политология опубликованные в Казахстанских научных журналах

Психология

В разделе "Психология" вы найдете публикации, статьи и доклады по научной и практической психологии, опубликованные в научных журналах и сборниках статей Казахстана. В своих работах авторы делают обзоры теорий различных психологических направлений и школ, описывают результаты исследований, приводят примеры методик и техник диагностики, а также дают свои рекомендации в различных вопросах психологии человека. Этот раздел подойдет для тех, кто интересуется последними исследованиями в области научной психологии. Здесь вы найдете материалы по психологии личности, психологии разивития, социальной и возрастной психологии и другим отраслям психологии.  

Религиоведение

Научные статьи по дисциплине Религиоведение опубликованные в Казахстанских научных журналах

Сельское хозяйство

Научные статьи по дисциплине Сельское хозяйство опубликованные в Казахстанских научных журналах

Социология

Научные статьи по дисциплине Социология опубликованные в Казахстанских научных журналах

Технические науки

Научные статьи по техническим наукам опубликованные в Казахстанских научных журналах

Физика

Научные статьи по дисциплине Физика опубликованные в Казахстанских научных журналах

Физическая культура

Научные статьи по дисциплине Физическая культура опубликованные в Казахстанских научных журналах

Филология

Научные статьи по дисциплине Филология опубликованные в Казахстанских научных журналах

Философия

Научные статьи по дисциплине Философия опубликованные в Казахстанских научных журналах

Химия

Научные статьи по дисциплине Химия опубликованные в Казахстанских научных журналах

Экология

Данный раздел посвящен экологии человека. Здесь вы найдете статьи и доклады об экологических проблемах в Казахстане, охране природы и защите окружающей среды, опубликованные в научных журналах и сборниках статей Казахстана. Авторы рассматривают такие вопросы экологии, как последствия испытаний на Чернобыльском и Семипалатинском полигонах, "зеленая экономика", экологическая безопасность продуктов питания, питьевая вода и природные ресурсы Казахстана. Раздел будет полезен тем, кто интересуется современным состоянием экологии Казахстана, а также последними разработками ученых в данном направлении науки.  

Экономика

Научные статьи по экономике, менеджменту, маркетингу, бухгалтерскому учету, аудиту, оценке недвижимости и пр.

Этнология

Научные статьи по Этнологии опубликованные в Казахстане

Юриспруденция

Раздел посвящен государству и праву, юридической науке, современным проблемам международного права, обзору действующих законов Республики Казахстан Здесь опубликованы статьи из научных журналов и сборников по следующим темам: международное право, государственное право, уголовное право, гражданское право, а также основные тенденции развития национальной правовой системы.