Fusarium equiseti түрінің биоэкологиялық ерекшеліктері

Көкөністерді зардаптайтын зең түрлерінің әсерінен өнім түсімі мен сақтау мерзімі жылдан жылға азаюда. Ауру тудырушы саңыраукұлак түрлерінің биоэкологиялык ерекшеліктерін зерттеудің заманауи зерттеу әдістері арқылы түрге ажыратудың практикалық маңызы зор. Мақалада қызыл бұрыш (Capsicum annuum L.) фузариоз ауруын коздырушы зең түріне морфологиялык жəне молекулалык-генетикалык зерттеу жүргізілген. Фитопатогеннің таксономиялык орнын аныктауда морфологиялык ерекшеліктері накты бола бермейді. Осы максатта Fusarium equiseti (Corda) Sacc. фитопатогенді микромицеттің молекулалык-генетикалык идентификациясы полимеразалык тізбектік реакция әдісі аркылы жүзеге асты. Полимеразды тізбекті реакция кезінде 18S рРНҚ кодтаушы ген бірізділігін табуда NS1 жəне NS4 консервативтік праймерлері колданылды. 5.8S РНҚ кодтаушы ген бірізділігін жəне ішкі транскриптеуші спейсерлер жасау үшін ITS1 жəне ITS4 праймерлері колданылды. 26S рРНҚ генінде D1/D2 домені амплификациясы үшін NL-1 жəне NL-4, Fusarium oxysporum үшін FOF1 жəне FOR1 праймерлері, Fusarium equiseti үшін FEF1 жəне FER1 арнайы праймерлері колданылды. ДНҚ бөлігін секвенирлеуде алынған нуклеотидтік бірізділіктерді салыстыру аркылы жакын туыстык микроағзалар штаммдарға филогенетикалык талдау жасалды. Секвенирлеу нәтижесінде геннің нуклеотидтік бірізділігіне сүйене зерттелген штамм түрге ажыратылды. Молекулалык зерттеулермен катар штаммға микроскоптык, макро- жəне микроморфологиялык ерекшелігін аныктау максатында талдаулар жүргізілді.

Өсімдіктің ауруы — бұл өте күрделі патологиялык процесс. Өсімдіктерде ауру коздырғыш- тардың ішіндегі басты орынды алатындар фитопатогенді саңыраукұлактар [1]. Табиғатта өсімдік- тердің 200-дей түрінің ауру коздырушысы болып табылатын Fusarium Link. туысына жататын түрлер кең тараған [2]. Бұл туыстың түрлері топыракта органикалык заттармен жəне өсімдіктерде факуль- тативті паразитті коректеніп, соңғыларында ауру туғызады. Макроконидилері орак, ұршык тəрíзденген, əлсíз иілген, екі ұшы сүйірленген, кейде жіп тәрізді 3-6 жасушаға бөлінген. Таза себінді екпесінде әртүрлі ашық түсті үлпілдек жіпшумақты, дифференцияланған немесе аздап тармақталған конидия сағактары болады [3–5].

Фузариум туысы Tuberculariaceae тұкымдасына жатады. Бұлардың конидия сағактары спородохияға жинакталған. Фузариум туысына жататын саңыраукұлактардың басым көпшілігі фитотрофты.

Конидияларының диагностикалык белгісі — дөңестігін Д.Ф.Л. Шлехтендаль жəне А.К. Корда талдаған. Fusarium түрін бөліп алу макро-, микрокондиялары, хламидоспоралары, сонымен катар колония көрінісіне, коректік ортада өсу жылдамдығына, пигментациясына карай ажыратылады [3; 58].

Ауру коздырушы патогеннің түрін дəл аныктау максатында зерттеу жұмысы жүргізілді. Түрдің идентификациясы барлык биологиялык зерттеулердің негізгі баспалдағы болып табылады. Дұрыс идентификациялау əрбíр түрдің биологиялық, экологиялық ерекшеліктерімен қатар, физиологиялық жəне биохимиялык кұрамын аныктаудың, сонымен катар саңыраукұлак түрі тудыратын аурумен күресу шараларын жасаудың бастамасы. Түрдің таксономиялык орнын аныктауда морфологиялык ерекшеліктерін сипаттаумен қатар, саңырауқұлақ түрлерінің ДНҚ бірізділігінің əрт-урлиНне негізделе идентификациялау жүйесі маңызды кадамдардың бірі.

Зерттеу материалдары мен әДістері

Алматы облысы, Қарасай ауданы, Қайнар аулында орналаскан «Қазак картоп жəне көкөніс шаруашылығы ғылыми-зерттеу институты» егістік алкабынан алынған кызыл бұрыштың (Capsicum annuum L.) фузариоз ауру қоздырушы түріне зерттеу жүргізгенде фузариоз (құрғақ шірік) ауруы қоздырушысының түрін ажырату үшін морфологиялық ерекшеліктерімен қатар, фитопатогеннің таксономиялық жүйедегі орнын нақты анықтау мақсатында молекулалық талдау əдíсí қолданылды.Микроскоптық зерттеуде жарық Muκpocκo∏bi (Micros Austria Camera 519 Cu 5 Otcmos бейне- KoHgbipFbicbiMeH MCX100, Muκpocκoπ oкуляpы EW10X/20, oбъекτиві PLAN 40X/0.65) (Micros, Австрия) жəне сканерлеуші микроскоптары (JSM-6510LA Analytical Scanning Electron Microscope, «JEOL», Жапония) пайдаланылды.

Саңырауқұлақ түрлерінің таза eκπeci картоп-декстрозды агарда (КДА) 27 ºС температурада өсірілді. 10-тəулíкте колонияларға ажыратылып, 18S рРНҚ талдауды үшін биомассасы алынған соң, ДНҚ бөліп алу жұмыстары СТАВ әдісі хаттамасына сəйкес жүргізілді [6]. Capsicum annuum L. жемісін зақымдаған фузариоз ауруы қоздырушысының таза екпесіне, яғни, бір штамм бойынша зерттеу жүргізілді. Филогенетикалық талдау жасау үшін зерттелген штаммды GenBank базасындағы Fusarium туысы түрлері мен басқа саңырауқұлақ изоляттарымен салыстырылды.

ДНҚ үлгілерін одан əрí пайдалану үшін 4 ºС температурада сақталды. ДНҚ концентрациясы спектрофотометр (Nanodrop Thermo ND-1000, Thermo Scientific, Массачусетс, АҚШ) пайдалана отырып, 900 нг/мкл (OD260) өлшенді.

Əрбíр ПТР реакциясы 50 мкл соңғы көлемінде жүргізілді жəне 5,0 мкл КСİ бар 10x Taq буфферден тұратын (Thermo Scientific, Массачусетс, АҚШ), 2,5 мM MgCl2 3,0 мкл, 100 mM 8,0 мкл дНТФ, əрбíр праймерден 1 мкл, 5Шмкл Taq ДНҚ полимераза-рекомбинант (Thermo Scientific, Массачусетс, АҚШ) 0,25 мкл, 27,8 мкл стерилді дистилденген су жəне 4 мкл ДНҚ үлгі ретінде пайдаланылатын саңырауқұлақ түрінің ДНҚ суспензиясы (100 нг). ПТР амплификация бағдарламасы бойынша ДНҚ сынамасы 5.8S РНҚ кодтаушы ген бірізділігін жəне ішкі транскриптеуші спейсерлер жасау үшін ITS1 жəне ITS4 праймерлері ITS1 — TCCGTAGGTGAACCTGCG жəне ITS4 — TCCTCCGCTTATTGATATGC қолданылды. 3 минут 95 ºС температурада денатурациялануын қамтамасыз етеді, сонымен қатар, 95 ºС — 30 секунд, 57 ºС — 50 секунд жəне 72 ºС 30 секундқа созылатын 35 айналымнан тұрады, ақырғы элонгация сатысы 72 ºС 5 минут жүргізілді.

26S рРНҚ генінде D1/D2 домені амплификациясы үшін NL-1 GCATATCAATAAGCGGAG- GAAAG жəне NL-4 GGTCCGTGTTTCAAGACGG праймерлері үшін ПТР бағдарламасы 3 минут 95 ºС температурада денатурациялануын қамтамасыз етеді, 95 ºС 30 секунд, 52 ºС 50 секунд жəне 72 ºС 30 секундқа созылатын 35 айналымнан тұрады, ақырғы элонгация сатысы 72 ºС 5 минут жүргізілді [7, 8].

Fusarium equiseti түріне FEF1 5'-CATACCTATACGTTGCCTCG-3' жəне FER1 5'-TTACCA- GTAACGAGGTGTATG-3' праймерлері, ал Fusarium oxysporum үшін FOF1 5'-ACATACCA- CTTGTTGCCTCG-3' жəне FOR1 5'-CGCCAATCAATTTGAGGAACG-3' арнайы праймерлері қолданылды. ПТР бағдарламасы 3 минут 95 ºС температурада денатурациялануын қамтамасыз етеді, 95 ºС 30 секунд, 52 ºС 50 секунд жəне 72 ºС 30 секундқа созылатын 35 айналымнан тұрады, ақырғы элонгация сатысы 72 ºС 5 минут жүргізілді.

Амплификацияланған ПТР өнімдері (10 мкл) жəне 100 п.н. ДНҚ сатысы (Thermo Scientific, Массачусетс, АҚШ) 0,5x TAE 1 сағат 30 минутқа 80 V/см буфферде 1,5 % агарозалық гель электрофорез арқылы ажыратылды. Агарозды гель бромды этидий (0,5 мкг/мл) 10 минутқа қойылды. Гель ультракүлгін сəуле астында суретке түсіру жүйесі арқылы түсірілді.

18S рРНҚ жəне 5.8S рРНҚ гендерін секвенирлеу АЕ 3000 автоматты секвенаторында (Applied Biosystems, АҚШ) жүргізілді. Алынған нуклеотидтік бірізділік BLASTn онлайн-сервисін қолдана отырып, GenBank [http://www.ncbi.nlm.nih.gov/blast] ақпараттық базасымен салыстырылды. Салыстыру нəтижесíнде штаммдардың қай түрге жататыны туралы қорытынды жасалды. Идентификация нəтижесíнде анықталған саңырауқұлақтардың атауларының өзектілігі түрлердің дұрыс жазылуы Mycobank ақпараттық базасының номенклатурасы көмегімен тексерілді.

Зерттеу нәтижелері жəне oΛap∂bi талдау

Fusarium equiseti (Corda) Sacc. түрі басқа Fusarium туысы штаммдарынан колониясының тез өсуімен (КДА-да 250С-да 6-тəулíкте диаметрі 6,0–8,0 см) ерекшеленеді. Конидияларынан тек макроконидиялары түзіледі, кейде аздап 1–2 жасушалы микроконидияларын кездестіруге болады. Парабола немесе гипербола тəрíздí, ортаңғы бөлігі кеңдеу, екі ұшы созылыңқы түрде сүйірленген (1-сур.). Негізінен 4-тен 8 жасушалыға дейін болады. 9– 13 жасушалылары өте сирек түзіледі. 1–3 жасушалылары 7–34×2,5–4,8 мкм, 4–12 жасушалылары 23–80×3–6 мкм. Конидияларының орташа өлшемі 56,83±1,33×4,57±0,01 мкм. Capsicum annuum L. жемісін зақымдаған.

18S рРНҚ кодтаушы ген бірізділігін талдауда біріншілік скрининг, GenBank ақпараттық мәліметтер базасында көрсетілгендей, қызыл бұрыш (Capsicum annuum L.) өсімдігінен бөлініп алынған штаммның келесі систематикалық топқа: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum түріне жататынын көрсетті. Филогенетикалық талдау жасауға бөлініп алынған 18S рРНҚ геніне негізделген GenBank базасындағы Fusarium туысы түрлері мен басқа саңырауқұлақ изоляттарына тұраралық ұқсастығына талдау жүргізілгенде штаммының бірнеше түрге жататыны анықталды.

Ұқсас түрлердің филогенетикалық туыстығын анықтау үшін 5.8S рРНҚ кодтаушы ген жəне ішкі транскриптеуші спейсерлер ITS1 жəне ITS2 аймағының нуклеотидтік бірізділіктерін салыстыру әдісі қолданылды. 5.8S рРНҚ кодтаушы ген бірізділігін жəне ішкі транскриптеуші спейсерлер ITS1 жəне ITS2 аймағының ДНҚ бөлігін секвенирлеуде алынған бірізділіктер төмендегі кестеде келтірілген.

Зерттеулер нəтижесí екі түрге Fusarium oxysporum, Fusarium equiseti жатататынын көрсетті. Алынған нəтиженí нақтылау мақсатында арнайы праймерлер қолданылды. Fusarium oxysporum үшін FOF1 жəне FOR1 арнайы праймерлері, Fusarium equiseti үшін FEF1 жəне FER1 праймерлері қолданылды. 2-суретте көрсетілгендей, FEF1 жəне FER1 арнайы праймерлерін қолданғанда 400 п.н. ұзындықта бірізділіктері оқылды. Бұл Fusarium equiseti түріне сəйкестíпн көрсетеді [8; 330].

FOF1 жəне FOR1 арнайы праймерлерін қолданғанда фрагменттердің оқылмауы зерттелген штаммның Fusarium oxysporum түріне жатпайтынын көрсетеді. Штаммға FEF1 жəне FER1 арнайы праймерлерін қолданғанда 389 п.н. ұзындықта бірізділіктерінің оқылуы зерттеліп отырған түрдің Fusarium equiseti (Corda) Sacc. түріне жататынын нақтылайды.

Нуклеотидтік бірізділіктерге жүргізілген зерттеу жəне морфологиялық сипаттама нəтижелерí зерттелген штаммның Penicillium aurantiogriseum Dierckx түріне жататынын көрсетті.

 

Əдебиеттер тізімі

  1. Хмельницкая И.И., Веприцкая И.Г., Аринбасарова М.У., Великанов Л .Л . // Микология и фитопатология. — 2003. — Вып. 3. — С. 58–63.
  2. Билай В.И. / Токсинообразующие микроскопические грибы / В.И. Билай, Н.М. Пидопличко. — Киев: Наук. думка, 1970. — 60 с.
  3. Leslie J.F. The Fusarium laboratory manual / J.F. Leslie, B.A. Summerell. — 1st ed. — Oxford, London: Blackwell Publishing Ltd, 2006.
  4. Салыбекова Н.Н. Көкөністерді зақымдайтын Fusarium туысы түрлерінің биологиялық ерекшеліктері / Н.Н. Салыбе- кова, Ж.Ж. Кужантаева, E. Басым, З.С. Ажибаева // Новости науки Казахстана. — Алматы, 2016. — № 1(127). — 99–112-б.
  5. Салыбекова Н.Н. Macrosporium commune Rabenh. жəне Fusarium martii Appel & Wollenw. түрлерінің көкөністерді зақымдау ерекшеліктері / Н.Н. Салыбекова, Ж.Ж. Кужантаева, Е. Басым, Ж.Т. Абдрасулова, Г.А. Бабаева // Əл-Фараби атындағы ҚазҰУ хабаршысы. Биология сериясы. — 2015. — № 2/2(64). — 444–452-б.
  6. Weising K. DNA fingerprinting in plants and fungi / K. Weising, H. Nybom, K. Wolff, W. Meyer. — CRC Press, Boca Raton, Florida, USA, 1995. — P. 336.
  7. Clerck E.De. Isolation, Characterization, and identification of bacterial contaminants in semifinal gelatin extracts / E.De. Clerck, T. Vanhoutte, T. Hebb, J. Geerinck, J. Devos, P.De. Vos // Applied and Environmental Microbiology. — 2004. — P. 3664–3672.
  8. Prashant K. Mishra. Development of a PCR-based assay for rapid and reliable identication of pathogenic Fusaria / Prashant K. Mishra, Roland T.V. Fox, Alastair Culham // FEMS Microbiology Letters. — 2003. — Vol. 218. — P. 329–332.
Тег: Талдау
Жыл: 2018
Категория: Биология