Сүйелді қайың (Betula Pendula) ағашын зақымдайтын фитопатогенді бактерияларды молекулалық идентификация тəсілі арқылы анықтап оның филогенетикалық шежіресін құру

Мақалада Нұр-Сұлтан қаласын қоршай отырғызылған жасанды «жасыл белдеу» орман шаруашылықтарында өсетін сүйелді қайың ағаштарының (Betula рendula Roth.) бактериялық обырмен зақымдалуына байланысты морфологиялық өзгерістері қарастырылып, ауру ағаш діңдерінен керн үлгілері алынып, бөлініп алынған бактерия культуралары қоректік орталарда өсіріліп, оларға культуралық-морфологиялық сипаттамалар берілді. Ауруға шалдыққан сүйелді қайың ағашы діңінен керндер алу, олардан ауру қоздырғыштың таза штамдарын бөліп алу, рибосомдық РНҚ 16S нуклеотидтік тізбегінің молекулалық идентификациясы жəне осы нəтижелерді халықаралық Gene Bank базасындағы тиісті мəліметтермен салыстыра зерделеу жұмыстары бактериология жəне ботаника салаларында қолданыстағы заманауи тəсілдер арқылы жүргізілді. Бөлініп алынған бактерия штамдарының молекулалық сипаттамалары халықаралық Gene Bank базасындағы типтік Dickeya dadantii штамына 96,72 %-ға сəйкес келді.

Кіріспе

Қайың ағаштарының бактериялық обыры — бұл туыстың өте зиянды өзекті — паренхиматозды ауруы болып табылады. Аурудың басты белгілері ағаш діңінің əр жерінде, кейде бұтақтарында, перидерма бетінде сарғыш-қызғылт түсті дақтардың пайда болуынан басталады. Бірте-бірте мұндай дақтардың орны ісініп, үлкейіп, сонан соң жарылады. Жарықшақтардан ақшыл-қоңыр, жағымсыз иісті сұйық сыртқа аға бастайды. Сыртқа шығып төмен қарай қабық бетіне жайылған сұйық тез кебеді, алыстан көзге түсетін көлемді сарғыш-қоңыр даққа айналады. Оның жоғарғы жағындағы жара жазылмайтын қатпаршақ кебу жараға айналады. Уақыт өте келе мұндай жараның орны үлкейіп, қасаңданып, сыртқы қабығы түсіп қалады. Ауру ағаш діңіне тереңдей еніп өзекті қамтиды, өткізгіш ұлпалар бұзылады, бітеледі, жапырақтар солғын тартып, түсе бастайды. Кейбір бұтақтары қурап қалады. Ағаш сұлбасы селдіреп, ақыр соңында ағаш өледі.

Ағаш тектестердегі бактериялық обырды зерттеулер 1945 жылы жарияланған J.C. Carter еңбегінен [1] бастау алады. Ол қарағашта кездесетін сулы бактериозды «wetwood» (дымқыл дің) деп, қоздырғышын — Erwinia nimipressuralis деп анықтап, оған алғаш сипаттама берген ғалым.

1963 жылы А.Л. Щербин-Парфененко [2] 22 түрге жататын қылқан жапырақтылардан бактериялық обырды анықтап, қоздырғыштарына грамтеріс, спора түзбейтін Erwinia multivora деп сипаттама берді. Өткен ғасырдың 70-ші жылдары жүргізілген зерттеулер [3] Зауралья, Оңтүстік Батыс Сібір жəне Солтүстік Қазақстан ормандарында қайың ағаштарында бактериялық обырдың қарқынды тарала бастағанын көрсетті. Қазақстанда бұл аурудың таралу аймақтарына Қостанай, Солтүстік Қазақстан, Павлодар облыстары кірді. Соңғы кездері жарияланған мəліметтерде Қазақстан жерінде қайың ағаштарындағы обыр қоздырғыштары жайлы алғашқы əдеби мəліметтерде келтірілген грамтеріс факультативті аэробты бактерия Erwinia multivora емес, басқа Pseudomonas sp., Enterobacteriaceae sp., Pectobacterium caratovorum жəне Dickeya dadantii сынды бактериялар анықталғандығы келтірілген [4].

Erwinia туысы Enterobacterales қатарына жататын фитопатогенді бактериялар тобы. Көлемі 1–3×0,5–1 мкм грамтеріс таяқша тəрізді, факультативті анаэробтар. Бұл туысты Winslow et al. [5] 1917 жылы анықтап, оған америкалық патологанатом Erwin F. Smith есімін берді. 1945 жылы Waldee [6] Erwinia туысын Pectobacterium деп ауыстыруды ұсынды. 1968 жылы Dye [7] биохимиялық сипаттамаларын негізге ала отырып Erwinia туысын төрт түрге бөлді: Erwinia amulavorа — алма ағашының жəне басқа да раушан тұқымдастарының (Rosaceae (Spiraeoideae) патогені, жеміс дақылдарының бактериялық күйік ауруының қоздырғыштары; Erwinia carotavora — əртүрлі туыс өкілдерінің, оның ішінде картоптың, жер үсті бөліктерін, сондай-ақ жер асты бөліктерін де, оның ішінде түйнектерін зақымдап, ұлпаларының қараюы мен шіруін, жапырақтардың ширатылуы мен сарғаюын туындатады; Erwinia herbicola — астық тұқымдастарының бактериозының қоздырғышы. Соңғы төртінші топқа түрлік атау берілмей оны «ерекше Erwinia» тобы деп топтастырды. Келесі жылы (1969) сол Dye [8] Erwinia туысын беске бөлді: E. amylovora (var. amylovora, var. salicis, var. traceiphila, var. quercina, var. nigrifluens, var. rubrifaciens); E. herbicola (var. herbicola, var. ananas); E. uredovorus; E. stewartii жəне E. carotovora (var. carotovora, var. atroseptica, var. rhapontici, var. chrysanthemi, var. cypripedii). Осы жылы Dye-ның ұсынысы бойынша Bergey's Manual of Determinative Bacteriology 8-ші басылымында Erwinia carotavora түрі келесідей түрлер мен түр тармақтарына жіктелді: Erwinia cypripedii, Erwinia rhapontici, Erwinia carotovora var. atroseptica, Erwinia carotovora var. carotovora жəне Erwinia chrysanthemi [9].

Аталған түр тармақтарының ішінде E. сhrysanthemi ең патогенді бактериялардың бірі болып танылды. Кейінгі зерттеулер барысында оның 16 қосжарнақты жəне 10 даражарнақты өсімдік тұқымдастарында бактериоз ауруын қоздыратыны анықталған [10]. Сондай-ақ оның көптеген тропиктік жəне субтропиктік аймақтардың өсімдіктерін зақымдайтыны белгілі. Өсімдіктің тамырын, түйнектерін, шырынды етжеңді мүшелерін бұзатын жұмсақ шірік ауруын қоздырады, тамыр ксилемасын отарлап, өсімдікті жүйелі түрде зақымдайды.

Dye [11] 1978 жылы E. сhrysanthemi-дің патологиялық жəне биохимиялық қасиеттерін негізге ала отырып, оны бірнеше патоварианттарға жіктеді (pv. zeae, pv. dieffenbachiae, pv. parthenii жəне pv. dianthicola). 1980 жылы Dickey жəне Victoria банан өсімдігінен анықталған жаңа патовариантты pv.paradisiaca-ны E. сhrysanthemi-мен біріктірді. 1998 жылы 16S рДНК нуклеотидтік тізбегін негізге ала отырып Hauben et al. [12] E. сhrysanthemi-ді жаңа атау алған Pectobacterium туысына кіргізіп P. сhrysanthemi деп атауды ұсынды. Кейіннен E. chrysanthemi pv.рaradisiaca-ны Brenneria рaradisiaca деп атап жаңа таксондық статус берді жəне түр деңгейіне көтерді [12].

2005 жылы фенотиптік тест, ДНҚ-ДНҚ гибридизация, серология жəне 16S рДНК нуклеотидтік тізбегін талдау көмегімен Samson et al. Е. сhrysanthemi-ді Erwinia туысынан бөліп алып, оған белгілі микробиолог Dickey R.S. есімін беріп, жаңа статусқа — Dickeya туысына көтерді [10]. Сонан соң, осы туысқа Pectobacterium сhrysanthemi мен Brenneria рaradisiaca-ны кіргізді. Сонымен, ол Dickeya туысына 6 түрді жатқызуды ұсынды: D. chrysanthemi, D. dadantii, D. dianthicola, D. dieffenbachiae, paradisiaca жəне D. zeae.

Жалпы, Dickeya Pectobacteriaceae тұқымдасына кіретін, əр түрлі климаттық жағдайларда өсімдіктің көптеген түрлерін зақымдайтын, кең ауқымды бактерия туысы. Басқа бактериялардан айырмашылығына: жоғарғы температурада максималды агрессивтілігі, өсімдіктен өсімдікке насекомдар арқылы тасымалдануы, өсімдіктің өткізгіш жүйесі арқылы өсімдік денесіне тез таралуы, төменгі температурада латенты күйде сақталуы жатады. Dickeya мына өсімдіктердің патогені болып табылады: D. dianthicola — картоп, қызанақ, қалампыр, құртқашаш; D. dieffenbachiae — картоп, ананас, банан, жүгері, құртқашаш, батат жəне пеларгония; Dsolani — картоп, қызанақ; D. paradisiaca — банан; D. chrysanthemi — қызанақ, картоп, темекі, сəбіз, хризантема; D. zeae — жүгері, бидай, картоп, ананас, банан, темекі, күріш, қырыққабат, хризантема, қалампыр. Сонымен қатар, 2013 жылы recA, dnaX, rpoD, gyrB мультилокусты тізбектерінің талдауы жəне 16S рДНК; ПЦР геномдық дактилоскопия жəне биохимиялық тесттер нəтижесіне сүйене келе, жапондық ғалымдар Dickeya туысын 24 əр түрлі өсімдік түрлерінен бөліп алып, оларды 6 топқа топтастырды: І топD. chrysanthemi, II — D. dadantii, III — D. dianthicola, IV — D. zeae., V жəне VI топтарға жаңадан анықталмақ түрлер жатқызылды [9].

Ағаштектестердің бактериялық обыры басқа өсімдіктер түріне қарағанда аз зерттелген. Ағаштектестердің ішінде бактериялық обырдың ең көп зақымдайтыны қайың ағаштары (Betula pendula) мен кедр қарағайы (Pinus sibirica). Бактериялық обырмен Оралдың еуропалық бөлігі аумағында, Батыс жəне Солтүстік Сібір, Таяу Шығыс, Беларусия, Солтүстік Қазақстан орман алқаптарының қайың ағаштары зақымдалған. 2007 жылы қайыңның бактериялық обыры Ресейдің 11 аймағынан 11,7 мың га, 2012 жылы Урал аймағында 3 мың га, Солтүстік Қазақстан жерінде 2013 жылы 5 мың га таралғаны анықталған. Сондай-ақ, бұл ауру Ресей жерінде Betula туысының барлық ареалына таралған [1]. Мұнда 2016 жылы 51 мың га аумақта кедр ағаштары зақымдалып, оның 5,7 мың га қурап, жойылған.

Бактериоз, басқа да ондаған ағаштектестерді залалдайды: самырсын, шырша, балқарағай, емен, шамшат, қарағаш, жөке, шаған, қайың, тал жəне т.б. Бұрынғы дерек көздерге сүйенсек, бактериялық обырдың қоздырғышы ретінде екі көзқарас қалыптасқан: бірі Erwinia multivora Scz.-Parf. [13], екіншісі Erwinia nimipressuralis Carter [1].

Соңғы мəліметтерде Қазақстанның солтүстік аудандарында бактериялық обырға шалдыққан қайың ағаштарынан Enterobacteriaceae тұқымдасына жататын Dickeya dadantii-ге cəйкес (93 %) келетін фитопатогенді бактерия штамдары анықталған [4]. Ал Dickeya dadantii иелік өсімдіктерінің құрамы жағынан кең спектрлі бактерия екені белгілі. Сонымен, Солтүстік Қазақстан аумағындағы қайың ағаштарында кездесетін бұл ауру қоздырғышты О.Н. Мироненко, С.А. Кабанова ж.б. [4] бір ғана бактерия түрі емес, олардың генерализацияланған тобы болуы мүмкін дейді [4]. Соңғы жылдары жүргізілген шет елдік ғалымдардың зерттеулерінде ағаштектестердің бактериялық обыры патологиясының себепкері ретінде бұрындары ешқашан ағаштектестерде анықталмаған бактериялар Pectobacterium (Erwinia) carotovorum жəне Dickeya spp. келтірілген [14]. Оның себебін ауру қоздырғыштарды идентификациялау кездері ағаш діңіндегі обыр жарадан аққан сұйыққа əр түрлі себептермен кейіннен келіп түскен аталмыш бактериялардың да есепке алынып кетуінен болар деп те жорамалдауға негіз бар.

Зерттеу əдістері мен нəтижелері

Зерттеу материалдары жаз жəне күз айларында Нұр-Сұлтан қаласын қоршай отырғызылған жасанды жасыл белдеу орман шаруашылықтарынан (Қызылжар о/ш, Вячеславка о/ш, Аршалы о/ш,) алынды. Аталмыш шаруашылықтардың таңдалып алыну себебі, мұнда қайың ағаштарының көптеп отырғызылуында жəне олардың жас шамаларының əрқалай (15–30 жыл) болуы. Осы орман шаруашылықтары аумағында ертеректе, өткен ғасырдың 70-ші жылдары отырғызылған жəне олармен аралас өскен табиғи қайыңды шоқ ормандар да кездеседі. Жасанды жасыл белдемдегі екпе отырғызылымдардағы көптеген ауру түрлері, оның ішінде бактериялық обыр да, осы ескі шоқ ормандардан таралуы əбден ықтимал.

Зерттеу жұмыстары Л.Н. Гумилев атындағы Еуразия ұлттық университетінің биология жəне геномика кафедрасына қарасты зертханада жəне ҚР Ұлттық биотехнология орталығы базасында жүргізілді.

Аурудың белгісі бар, морфологиялық өзгеріске ұшыраған қайың ағаштарының діңінен арнайы Haglof бұрғысы (ұз. 100–500 мм, дм 4,3 мм) арқылы көлденең бағытта керндер алынды (1-сурет). Алынған керндер (3–12 см) сыртынан 90 %-дық этил спиртімен сүртіліп, стирильді пробиркаларға салынып, пайдаланғанға дейін тоңазытқышта 3–4 ºС-та сақталды. Керндерден ауруға шалдыққан ағаш діңінің қабығынан (тоз, перидерма) бастап камбийдің, сүректің, ондағы трахеялық элементтердің (флоэма, ксилема), сүректік талшықтар (либриформа) мен паренхиманың жəне өзектің зақымдалатынын көруге болады. Бұл аурудың түтікті-паренхималы індет екенін дəлелдейді. Керндерден ауру қоздырғыштарды бөліп алып, олардың таза штамдарын алу үшін əртүрлі жасанды қоректік орталар пайдаланылды (стандартты агар, картопты агар, ет-пептонды агар, эндо). Стирильді жағдайда, ламинарлық бокс камерасында керндердің ұзына бойының əр жерінің ішкі тұсынан көлемдері 0,8–1 мм болатындай бөлшектері кесіп алынып, Петри табақшаларындағы қоректік орталарға отырғызылды. Осылай инокуляцияланған қоректік орталар термостатта 26,5 ºС-та инкубацияланды. Пайда болып өсе бастаған екпе колониялар күн сайынғы бақылауға алынып, сипаттамалары (колониялар бітімі мен пішіні, тығыздығы, түсі жəне өсу қарқындылығы) жасалды. Қоректік ортадағы бактерия колонияларын басқа микроорганизмдерден тазарту үшін қайта өрмек тəрізді себу əдісі қолданылды (1-сурет).

Қоректік ортада өсе бастаған 5 күндік бактерия колонияларының сипаттамасы келесідей: коллониялар керн дискісін жиектей орналасқан, жиектері тарамдалмаған, біркелкі емес, толқын тəрізді, түсі ақ, керн дискілерінен 0,2–0,4 см шетке қарай тараған. Тазартылған 5 күндік екпе коллониялардың пішіні дискі тəрізді домалақ, түсі ақ-жылтыр, ақшылтым, жиектері тегіс, консистенциясы тығыз, қоймалжың, көлемдері 9×10 мм, 4×7 мм, 3×6 мм,4×6 мм, 5×9 мм.

Гендік типтеу мақсатында бактерия культураларынан ДНҚ-ны бөліп алу үшін алдымен шыны пробиркадағы культураларды пластикалық пробиркаға ауыстырып, культураның 1 мл мөлшері пайдаланылды. Бұл үдеріс Kate Wilson [15] əдісімен іске асырылды. Алынған үлгі центрифугаға 10 минутқа 12000 мин/айналымға қойылды. Тұнбаға 500 мкл ТЕ буферін араластырып (суспензия- лап), оған 20 мкл лизоцим қосып 37 ºС-та 1 сағат инкубацияладық. Сонан соң 30 мкл мөлшерде 10 % SDS жəне 3 мкл К протеиназа (20 мг/мл) қостық. Оған жасуша мембранасының фрагменттерін, полисахаридтер мен ақуыздардың қалдығын жою үшін 100 мкл 5М NaCl қосылды. Вортексте араластырып, үстіне 80 мкл CTAB (10 % CTAB-та 07 M NaCl) ерітіндісі қосылды. Қайтадан вортексте араластырып 65 ºС-та 10 минут инкубацияладық. Содан соң бөлініп алынған ДНҚ-ны фенол/хлороформ əдісімен тазаладық. Ол үшін алынған суспензияға 700 мкл хлороформ/изоамил спиртін (24/1) қосып, шайқап, 12000 мин/айналымда 10 минут центрифугаладық. Бөлінген су бөлігін жаңа пробиркаға құйып алып, тағы да фенол/хлороформ (1:1) қоспасын қосып, центрифугалап, культураның қажет емес басқа белок жəне клетка мембранасының қалдықтарынан тазаладық. Сонан соң, оның жоғарғы сұйықтық бөлігін (1,5 мл) жаңа пробиркаға құйып алып, оған 600 мкл изопропил спиртін қосып, ДНҚ-ны тұндырып алдық. Пробирканың түбінде тұнған ДНҚ-ны 70 % этил спиртімен шайып алып, тазаланған ДНҚ үлгілеріне 100 мкл ТЕ буферін қосып –20 ºС-қа мұздатқышқа салып қойдық. Бөлініп алынған ДНҚ үлгілерінің концентрациясы 260 нм толқын ұзындығында NanoDrop спектрометрдің көмегімен анықталды.

16SrRNA гені фрагментінің амплификациясы. ПТР келесідей əмбебап праймерлермен жүргізілді: 8f 5'-agagtttgatcctggctcag-3 жəне 806R-5'ggactaccagggtatctaat, жалпы мөлшері 20 мкл. ПТР қоспасында 150 нг ДНҚ, 1 бірлік MaximaHotStartTaqDNAPolymerase (Fermentas), əр біріне 0,2 mM дНҮФ (дезоксинуклеозодоүшфосфат), бір реттік ПТР буфер (Fermentas), 2,5 mM MgCl2, əр бірінде 10 п/моль праймер бар. ПТР амплификациясының бағдарламасы бойынша алғашқыда 95 ºС-та денатурация жасалады, сонан соң кезектесе жүретін 30 цикл: 95 ºС-та 30 секунд, 55 ºС — 40 секунд, 72 ºС — 1 минут, соңғы элонгация 72 º С-та 7 минут бойы жүріп аяқталады.

Нуклеодтидтік тізбекті анықтау. Байланыспаған праймерлерден ПТР өнімін тазалау үшін ферменттік əдіс Exonuclease I (Fermentas) мен сілтілік фосфатаза (Shrimp Alkaline Phosphatase, Fermentas) пайдаланылды. Ал секвендеу реакциясы BigDye® Terminator v3.1 Cycle Sequencing Kit (Applide Biosystems) өндірушінің қолдану ережесі бойынша 3730xl DNA Analyzer (Applide Biosystems) автоматты генетикалық анализаторда, нуклеотидтік тізбекті фрагменттерге ретімен бөлетін секвенаторды қолдану арқылы жүзеге асты. ПЦР бағдарламасы BioRad T100 (BioRad) амплификаторын қолдану арқылы орындалды.

Жоғарыда баяндалғандай ауру ағаш діңдерінен (керндерінен) бөлініп алынған таза культуралық штамдарды секвендеу негізінде олардың 16SrRNA-дың 8f жəне 806R нуклеотидтік тізбегінің реттіктері анықталды. Алынған тізбек SeqMan (ApplideBiosystems) бағдарламасына енгізілді. Сонан соң, олардың ұштық фрагменттері (сапасы төмен праймерлері мен фрагменттердің нуклеотидті көрсететін реттері) алып тасталды. Алынған тізбек GeneBank мəліметтер базасындағы BLAST —

(Basic Local Alignment Search Tool) пайдалана отырып, оған туыс келетін түрлер жəне олардың ара қатынастарын (сəйкестіктері) көрсететін филогенетикалық шежіресі құрылды (2-сурет). Алынған нəтижелерді есептеу секвенделген 16SrRNA тізбегінің 650 сайттары бойынша жүргізілді. Филогенетикалық шежірені құру Clustal Omega < Multiple Sequence Alignment < EMBL-EBI компьютерлік бағдарламасы пакетіндегі ақиқатқа барынша жақындау əдісі арқылы іске асырылды.

Нəтижесінде зерттелген бактериялық обыр штамдарының нуклеотидтік тізбегінің реттік тəртібі, бактериялардың GeneBank-тегі 16SrRNA нуклеотидтік тізбектерінің Dickeya dadantii subsp-ке 96,72 %-ға ұқсастығын (гомологтылығын) көрсетті. Аталған штамның нуклеотидтік тізбегінің реті негізінде оның басқа түрлер арасындағы филогенетикалық туыстық қарым-қатынастары анықталды (2-ші суретте). Дендрограммада DDdd-1 Dickeya dadantii штамы (біздің штамм) Генбанктегі іріктеліп алынған Erwinia chrysanthemi штамдар тобына сəйкес келді. Сондықтан DDdd-1 штамы екі жақын туысты (Dickeya dadantii жəне Erwinia chrysanthemi) біріктіретін кладқа сəйкес келді.

Зерттелген үлгінің филогенетикалық шежіресінде (древа) біздің штамм DDdd-1 16SrRNA нуклеотидтік тізбектері бойынша GeneBank-тегі NR041921.1 Dickeya dadantii, KJ541470.1 Erwinia chrysanthemi, AF373175.1 Erwinia chrysanthemi бактерияларымен жақын туыстық қарым-қатынасты көрсетті. Жалпы, Dickeya dadantii өсімдіктің көптеген түрлерін зақымдайтын бактерия түрі. Мысалыға: картоп, бұрыш, темекі, күріш, спаржа, пияз, сельдерей, ананас, сəндік өсімдіктерден: орхидеялар, қызғалдақтар, циклорий, драценалар, амариллис, бегония, хризантема, каланхоэ, соңғы жылдары ағаштектес өсімдіктерден де анықталған. Ол су, жел жəне насекомдар арқылы таралып, жоғары ылғалдылық пен температурада (71 º-тан 93º) тіршілігін жалғастыратын патоген. Ал, Erwinia chrysanthemi қызанақ, картоп, темекі, сəбіз, хризантема өсімдіктерінде дымқыл қоңыр немесе қара түсті жаралар тудырады. Аталмыш екі түрдің таралуы мен өсімдіктердің түрлерін зақымдау бары- сында біршама айырмашылық болғанымен, 16SrRNA нуклеотидтік тізбектерінде үлкен ұқсастық бар. Кейіннен осы ұқсастықтарды ескере отырып жəне де 16S рДНК нуклеотидтік тізбегін талдау арқылы Samson et al. Е. сhrysanthemi-ді Erwinia туысынан бөліп алып, оған белгілі микробиолог 2005 жылы Dickey R.S. есімін беріп, жаңа статусқа — Dickeya туысына көтергені жайлы жоғарыда айтылды.

Қорытынды

Сонымен, Нұр-Сұлтан қаласын қоршай орналасқан жасыл белдемде өсіп тұрған қайың ағаш- тарында кездесетін бактериялық обырдан бөлініп алынған бактерия штамдарын культура- лық-морфологиялық жəне молекулалық-гендік зерттеулер нəтижесінде жəне халықаралық Генбанктегі сəйкес түрлермен салыстыра талдау негізінде Pectobacteriaceae тұқымдасының Dickeya туысына жататын түр — D. dadantii pv. Betulaе деп санаймыз. Оның дəлелін 2-суретте келтірілген туыстық қатынастары жақын түрлердің филогенездік шежіресінен көруге болады. Біздің түрмен (DDdd-1 Dickeya dadantii) бір кладтағы түрлерді (индекстік номерлері əр түрлі Erwinia chrysanthemiDickeya dadantii-дің синонимдері деп қарастыруға негіз жеткілікті. Себебі жоғарыда келтірілген шолудан байқасақ, иелік өсімдіктерге сəйкестенуі өте кең ауқымды бұл патогенді (Erwinia chrysanthemi) əр зерттеуші кезінде əр түрліше атаған. Жалпы, Dickeya туысы түрлер құрамы жағынан, олардың бір-бірімен туыстық жақын-алшақтықтары тұрғысында жəне иелік өсімдіктерінің құрамдары жағынан əлі де көп зерттеулерді қажет ететін күрделі таксон.

Əдебиеттер тізімі

  1. Carter J.C. Wetwood of elms / J.C. Carter // Bull. Illinois Nat. Hist. Surv. — 1945. — P. 401–448.
  2. Черпаков В. В. Бактериальный ожог лесных пород / В. В. Черпаков // Тез. докл. III Всесоюз. конф. по бактериальным болезням растений. — Тбилиси, 1976. — С. 195–197.
  3. Щербин-Парфененко А.Л . Бактериальные заболевания лесных пород / А.Л . Щербин- Парфененко. — М.: Гослесбум- издат, 1963. — 148 с.
  4. Мироненко О.Н. Бактериальное заболевание березняков в Казахстане / О.Н. Мироненко, С.А. Кабанова, О.Ю. Баранов, М.А. Данченко // Вестн. ПГТУ. — 2016. — № 6. — С. 90.
  5. Winslow C.-E.A. The families and genera of the bacteria. Preliminary report of the committee of the Society of American Bacteriologists on characterization and classification of bacterial types / C.-E.A. Winslow, J. Broadhurst, R.E. Buchanan, C. Jr. Krumwiede, L.A. Rogers, G.H. Smith // J. Bacteriol. — 1917. — P. 505–566.
  6. Waldee E.L. Comparative studies of some peritrichous phytopathogenic bacteria/ E. L.Waldee // Iowa State J. Sci. — 1945. — Vol. 19. — P. 435–484.
  7. Dye D.W. A taxonomic study of the genus Erwinia. I. The, «amylovora» group / D.W. Dye // New Zeal. J. Sci. — 1968. — Vol. 11. — P. 590–607.
  8. Dye D.W. A taxonomic study of the genus Erwinia. II. The «carotovora» group / D.W. Dye // New Zeal. J. Sci. — 1969. — Vol. 12. — P. 81–97.
  9. Suharjo R. Phylogenetic study of Japanese Dickeya spp. and development of new rapid identification methods using PCR– RFLP / R. Suharjo, H. Sawada, Y. Takikawa // J. Gen. Plant. Pathol. — 2014. — Vol. 80. — P. 237–254.
  10. Лазарев А.М. Новый возбудитель бактериоза картофеля атакует российские поля / А.М. Лазарев // Защита и карантин растений. — 2013. — № 6. — C. 11.
  11. Dye D.W. A proposed nomenclature and classification for plant pathogenic bacteria / D.W. Dye // New Zeal. J. Agric. Res. — 1978. — Vol. 21. — P. 153–177.
  12. Hauben L. Phylogenetic position of phytopathogens within the Enterobacteriaceae / L. Hauben, E.R.B. Moore, L. Vauterin, M. Steenackers, J. Mergaert, L. Verdonck, J. Swings // Syst. Appl. Microbiol. — 1998. — P. 384–397.
  13. Шелухо В.П. Бактериальная водянка березы и эффективность мероприятий по борьбе с ней в насаждениях зон смешанных и широколиственных лесов / В.П. Шелухо, В.А. Сидоров. — Брянск: БГИТА, 2009. — 117 с.
  14. Черпаков В.В. Этиология бактериальной водянки древесных растений / В.В. Черпаков // Изв. СПб. лесотехн. акад. — 2017. — Вып. 220. — С. 125–139.
  15. Collins M.D. Deoxyribonucleic Acid Homology Studies of Lactobacillus caseiLactobacillus paracasei sp. nov., subsp. paracasei and subsp. tolerans, and Lactobacillus rhamnosus sp. nov., comb. nov. / D.M. Collins, A.B. Phillips, P. Zanoni // International Journal of Systematic Bacteriology. — 1989. — Vol. 39, Iss. 4. — P. 105–108.
Тег: Талдау
Жыл: 2020
Категория: Биология