Результаты исследования клещей на обнаружение вирусов Карши, Тамды, Иссык-Кульской лихорадки, лихорадки долины Сырдарьи

В Казахстане природные очаги Крымской-Конго геморрагической лихорадки расположены на территории Туркестанской, Кызылординской и Жамбылской областей. Это заболевание ежегодно диагностируется среди людей, проводятся профилактические мероприятия, однако есть группа вирусов, такие как Карши, Тамды, вирус Иссык-Кульской лихорадки и лихорадки долины Сырдарьи, о которых мало что известно. В связи с этим была поставлена цель — выявить распространённость вирусов Карши, Тамды, Иссык-Кульской лихорадки и лихорадки долины Сырдарьи на эндемичных по Крымской-Конго геморрагической лихорадке территориях, определить основных носителей и переносчиков инфекции. Клещи отлавливались на территориях, являющихся природными очагами вируса Крымской-Конго геморрагической лихорадки. Видовой состав отловленных клещей был представлен 9 видами: Hyalomma scupenseHyalomma asiaticumHyalomma turanicumHyalomma anatolicumHaemaphysalis sucataHaemaphysalis punctataDermacentor niveusRhipicephalus pumilioRhipicephalus schulzei. Предварительно были проведены работы по подбору и конструированию олигонуклеотидных праймеров для идентификации вирусов методом молекулярно-генетического анализа. В результате проведенных исследований были обнаружены положительные пробы к вирусам Тамды и лихорадки долины Сырдарьи в клещах H. asiaticum, H. scupense из Туркестанской области. Вирус Крымской-Конго геморрагической лихорадки был обнаружен в клещах H. asiaticum и H. Scupense из Жамбылской и Туркестанской областей.

Введение

Новые и возвращающиеся (emergingandre-emerging) вирусные инфекции человека представляют собой одну из глобальных проблем здравоохранения [1–3]. Опасность таких инфекций обусловлена внезапным появлением, быстрым распространением и отсутствием средств специфической защиты и профилактики. Основным источником новых вирусов человека являются зоонозные вирусы, которые под влиянием совокупности факторов приобретают патогенные для человека свойства и эпидемический потенциал [4, 5]. Значительная доля среди возбудителей этих инфекций принадлежит арбовирусам, преимущественно РНК-содержащим, которые передаются человеку посредством кровососущих членистоногих переносчиков. Одним из значимых природно-очаговых вирусных инфекций в Казахстане является Крымская-Конго геморрагическая лихорадка (ККГЛ) и геморрагическая лихорадка с почечным синдромом (ГЛПС). Проводимые ежегодно профилактические мероприятия среди населения дают определенные положительные результаты, одним из которых можно отметить ранее обращение населения в медицинские учреждения при укусе клещей [6–8]. Однако существует группа вирусов, переносимых клещами, такие как Карши, Тамды, вирус Иссык-Кульской лихорадки и лихорадки долины Сырдарьи, вызывающие лихорадочные состояния у людей. О них мало что известно, однако есть данные о том, что эти вирусы обнаруживали среди различных переносчиков инфекции в начале восьмидесятых-девяностых годов прошлого столетия серологическими методами диагностики [9–11].

Вместе с тем, на сегодняшний день данные о вирусах Карши, Тамды, Иссык-Кульской лихорадки и лихорадки долины Сырдарьи остаются крайне ограниченными. В связи с этим была поставлена задача — разработать специфичные для каждого вируса олигонуклеотидные праймеры с целью их обнаружения молекулярно-генетическим методом в различных видах клещах и определить их возможную этиологическую роль в возникновении лихорадок неясной этиологии у людей.

Материалы и методы

Клещи отлавливались как в открытых стациях методом «на флаг», так и снимались с сельскохозяйственных животных. Предварительно клещи объединяли в пулы в среднем по 10–12 экземпляров, измельчение проводили в гомогенизаторе «Mini-Bead Beater» с добавлением 700 мкл питательной среды Игла МЕМ. Выделение РНК из суспензии клещей совершали коммерческим набором «QIAGEN» (Германия) согласно инструкции производителя. Подбор и проверку специфических праймеров осуществляли с использованием программ Primer Select (DNAstar), BioEdit и веб-ресурса Primer Blast (NCBI). При подборе праймеров учитывали основные параметры: близкая температура отжига прямого и обратного праймеров, длина праймеров от 18–25 п.н., низкая вероятность образования вторичных структур. Амплификацию образцов РНК проводили на аппарате «Roche Light Cycler 2.0» с флуоресцентной детекцией результатов. Иммуноферментный анализ (ИФА) выполняли коммерческим набором «Вектор Крым КГЛ-антиген» (Россия).

Для нанесения точек отлова клещей использовали географическую информационную систему. Полученная информация была оцифрована посредством создания электронных баз данных в программе Excel, а затем адаптирована для работы в программе ArcGIS. Тематические слои включают местоположение точек обследования территории, места сбора клещей. Данные о видовой принадлежности клещей с указанием места сбора (координаты) были занесены в электронную базу данных для создания карты.

Результаты и их обсуждение

На первом этапе нашего исследования был проведен анализ литературных данных и нуклеотидных последовательностей рода Cardiovirus для конструирования олигонуклеотидных праймеров. Кардиовирусы входят в семейство Picornaviridae и вызывают тяжелые заболевания у грызунов и человека. В настоящее время отсутствует полногеномная последовательность вируса лихорадки долины Сырдарьи. В связи с этим целесообразно было провести подбор универсальных праймеров для выявления всех представителей рода Cardiovirus. В Международной базе данных нуклеотидных последовательностей (https://www.ncbi.nlm.nih.gov/) было найдено 64 полногеномных последовательностей от 14 представителей кардиовирусов. Выравнивание и филогенетический анализ последовательностей кластеризовал их в три клады. На основании полученных результатов были выбраны две стратегии подбора праймеров: первая — подбор трех пар праймеров и трех зондов, каждый набор на отдельную филогенетическую кладу; вторая — подбор универсального зонда и нескольких пар праймеров на вариабельные участки нуклеотидных последовательностей клад (табл. 1).

Таблица 1

Характеристика олигонуклеотидных праймеров для выявления вируса лихорадки долины Сырдарьи

Наименование праймеров

Последовательность 5’-3’

Длина

Tm, °C

CG, %

Первая стратегия подбора праймеров

CarSet1-TaqMan_F

FAM-cagaggaacgtcagcattttccggcc-BHQ1

26

64,2

57,7

CarSet1-F

ggtactgcgatagtgccacc

20

57,2

60,0

CarSet1-R

gttgacttagatctccaaccacgt

24

56,4

45,8

CarSet2-TaqMan_F

FAM-ctgcggccaaaagccccgtg-BHQ1

20

64,2

70,0

CarSet2-F

gtagcgacctcacagtagca

20

55,6

55,0

CarSet2-R

accttcaggacattcttggct

21

55,1

47,6

CarSet3-TaqMan_R

FAM-accttctgggcatccttcagccc-BHQ1

23

62,4

60,9

CarSet3-F

atgtcgtgaaggaagcagttcc

22

57,0

47,8

CarSet3-R

gcctagacgttttttaacctcgac

24

56,4

48,0

Вторая стратегия подбора праймеров

Cardio-uni-F1

caagaagacagctgtagcgacc

22

57,7

54,5

Cardio-uni-F2

caaacaacgtctgtagcgacc

21

56,4

52,4

Cardio-uni-F3

atcgaaacagctgtagcgacc

21

57

52,4

Cardio-uni-R1

aaggggtacctcctggacattc

22

57,1

54,5

Cardio-uni-R2

ggggtaccttctgggcatcc

20

58,6

65

Cardio-uni-R3

cggggtaccttcaggacattc

21

56,6

57,1

CarUni-TaqMan_F

FAM-ctgcggccaaaagccccgtg-BHQ1

20

64,2

70,0

Вирусы Тамды и Иссык-Кульской лихорадки относятся к роду Orthonairovirus. Геном Orthonairo- virus состоит из трех сегментов отрицательной одноцепочечной РНК. Сегмент М кодирует многопластинчатый полигликопротеин, который обрабатывается пептидазами-хозяев с образованием зрелых гликопротеинов оболочки (Gn и Gc), муциноподобный белок и другие потенциальные продукты [12].

Выравнивание нуклеотидных последовательностей всех представителей рода Orthonairovirus продемонстрировало высокую генетическую вариабельность на протяжении всей последовательности, что исключает подбор универсальных праймеров с дифференцирующими зондами. Наличие высококонсервативных домен позволяет рассматривать L-сегмент в качестве генетической мишени для подбора праймеров. В связи с высокой генетической вариабельностью были подобраны праймеры и флуоресцентные зонды к определенному вирусу (табл. 2).

Таблица 2

Характеристика олигонуклеотидных праймеров для выявления вирусов Иссык-Кульской лихорадки и лихорадки Тамды

Наименование

Последовательность 5’-3’

Длина

Tm, °C

CG, %

Issyk-kul-F1

gcacggctgtttgtaacttcc

21

56,9

52,4

Issyk-kul-R1

ccgagagtactcaatgcaagc

21

55,6

52,4

Issyk-kul-TM-1

FAM-catcgaccctatgctacctgatggca-BHQ1

26

61,7

53,8

Issyk-kul-F2

agtcttcttaacaactcacagcca

24

55,7

41,7

Issyk-kul-R2

catggaactcaaccttcctgc

21

55,7

52,4

Issyk-kul-TM-2

FAM-atgatgaggtttggactgctcagtgct-BHQ1

27

61,5

48,1

Tamdy-F1

ctaaactcacagccgttcaacaa

23

55,7

43,5

Tamdy-R1

cttgcgacataacactcgatgt

22

55,2

45,5

Tamdy-TM-1

FAM-cttgccccaaagagctcggcataa-BHQ1

24

61,4

54,2

Tamdy-F2

gctacattcttaattctgggcac

23

54

43,5

Tamdy-R2

cacgggcatgttccaagat

19

54,6

52,6

Tamdy-TM-2

FAM-ttgggcggccatcgagatttgctc-BHQ1

24

63,7

58,3

Вирус Карши относится к роду Flavivirus, семейство Flaviviridae и входит в группу переносимых клещами флавивирусов млекопитающих [13]. Данную группу составляют вирусы клещевого энцефалита, весеннего и летнего энцефалита России, Омской геморрагической лихорадки, вирус Лангата, вирус геморрагической лихорадки Альхурма, вирус Кьясанурской лесной болезни, вирус Powassan, вирус Royal Farm, вирус Карши. Вышеназванные вирусы ответственны как минимум за 10 000 клинических случаев клещевого энцефалита в год [14]. Флавивирусы представляют собой оболочечные вирусы с одноцепочечным положительным РНК-геномом, размер которого составляет приблизительно 11 тысяч п.н. [15]. Группа флавивирусов обладает высокой генетической гетерогенностью, считается, что фла- вивирусы с более 84 % идентичностью нуклеотидных последовательностей должны быть классифицированы в пределах одного вида, а идентичность между видами различных кластеров составляет 63–65 % [16].

В базе данных NCBI было опубликовано 3 последовательности геномов вируса Карши (DQ462443, AY863002 и DQ235147), при выравнивании нуклеотидных последовательностей которых была установлена высокая генетическая вариабельность. Праймеры были подобраны к консервативным участкам генома вируса, нуклеотидная последовательность праймеров приведена в таблице 3.

Таблица 3

Характеристика олигонуклеотидных праймеров для выявления вируса Карши

Наименование

Последовательность 5’-3’

Длина

Tm, °C

CG, %

karshi-F1

cagagcctytggatgaagtcca

22

56,8

52,3

karshi-R1

ctgggatctggttgtacatggt

22

55,8

50,0

karshi-TaqMan1

FAM-ctgcacttggccagatgagtacacca-BHQ1

26

62,4

53,8

karshi-F2

ggaatgacctattccatgtgtga

23

54,1

43,5

karshi-R2

gctctcacttgtattctgcagg

22

55,5

50,0

karshi-TaqMan2

FAM-cacagtggtgatggaggtgacctacac-BHQ1

27

62,4

55,6

Путем анализа литературных данных, анализа нуклеотидных последовательностей и их выравнивания были разработаны олигонуклеотидные праймеры для постановки ПЦР в режиме реального времени к вирусам Карши, Тамды, Иссык-Кульской лихорадки, лихорадки долины Сырдарьи. Всего было получено 24 олигонуклеотидных праймеров и 9 флуоресцентных зондов, из них: Karshi (вирус Карши) — 4 праймера, 2 зонда; Tamdy (вирус Тамды) — 4 праймера, 2 зонда; Issyk-kul (вирус Иссык- Кульской лихорадки) — 4 праймера, 2 зонда; CarSet, Cardio-uni (вирус лихорадки долины Сырдарьи) — 12 праймеров, 3 зонда.

Для проведения исследования клещи отлавливались на территориях Жамбылской, Кызылордин- ской, Туркестанской областей, являющихся эндемичными по Крымской-Конго геморрагической лихорадке. Клещи были собраны с сельскохозяйственных животных: крупного рогатого скота (КРС), мелкого рогатого скота (МРС), лошадей, в местах их обитания, в частных дворах и фермах. В природе на открытых стациях клещей собирали на «флаги». Отловленных клещей затем помещали в индивидуальные пробирки, с обозначением мест сбора, вида животного, даты сбора и количества экземпляров. Места отлова клещей и места обнаружения положительных находок были оцифрованы и размещены на карте (см. рис.).

Всего было отловлено 2804 клещей, из них из Туркестанской области — 444, Кызылординской — 818 и Жамбылской области — 1542 экземпляра. Результаты проведенного анализа показали, что видовой состав отловленных клещей представлен 9 различными видами: Hyalomma scupenseHyalomma asiaticumHyalomma turanicumHyalomma anatolicumHaemaphysalis sucataHaemaphysalis punctataDermacentor niveusRhipicephalus pumilioRhipicephalus schulzei, видовая принадлежность и численность отловленных иксодовых клещей по регионам представлены в таблице 4.

Таблица 4

Область

Hyal. scupense

Hyal. asiati- cum

Hyal. turani- cum

Hyal. anatoli- cum

Haem. sucata

Haem. punctata

D. niveus

Rhip. pumilio

Rhip. schulzei

Итого

Количество клещей

Туркестанская

186

138

21

0

54

0

25

20

0

444

Кызылординская

0

766

0

25

0

15

11

0

1

818

Жамбылская

0

305

0

0

0

0

1237

0

0

1542

Итого по видам

186

1209

21

25

54

15

1273

20

1

2804

Видовой состав и количество клещей, отловленных на территориях трех областей для проведения исследования

Всего было подготовлено 257 пулов суспензии клещей, из них из Туркестанской области — 54, Кызылординской — 93 и Жамбылской области — 110 пулов. Подготовленные пулы клещей были исследованы двумя методами: на наличие антигенов вируса ККГЛ, исследование было проведено методом ИФА; на наличие РНК вирусов Карши, Тамды, Иссык-Кульской лихорадки и лихорадки долины Сырдарьи, методом ПЦР с использованием разработанных праймеров. Результаты проведенных анализов приведены в таблице 5.

Таблица 5

Результаты исследования клещей методами ИФА и ПЦР

Область

Вирус ККГЛ (ИФА)

Вирус Карши (ПЦР)

Вирус Тамды (ПЦР)

Вирус Иссык-Кульской лихорадки (ПЦР)

Вирус лихорадки долины Сырдарьи (ПЦР)

Количество положительных проб/Общее количество проб

Туркестанская

1/54

0/54

2/54

0/54

1/54

Кызылординская

0/93

0/93

0/93

0/93

0/93

Жамбылская

1/110

0/110

0/110

0/110

0/110

Проведенный анализ клещей выявил 2 положительные к вирусу ККГЛ пробы методом ИФА (H. asiaticum и H. scupense), 2 положительные пробы к вирусу Тамды (H. asiaticum) и 1 положительную пробу к вирусу лихорадки долины Сырдарьи (H. scupense). Положительные пробы к вирусам Тамды и лихорадки долины Сырдарьи были дополнительно протестированы в ПЦР на наличие вирусов ККГЛ и клещевого энцефалита для исключения перекрестной реакции с другими вирусами.

Заключение

Таким образом, в результате проведенных исследований были получены сведения о естественной зараженности клещей H. asiaticum и H. Scupense вирусами Тамды и лихорадки долины Сырдарьи и роли этих видов клещей в сохранении и передаче вирусов. Обнаруженные методом ИФА положительные на ККГЛ пробы были выявлены в клещах H. asiaticum и H. scupense. Полученные результаты показывают, что клещи H. asiaticum и H. scupense остаются на сегодняшний день одними из основных переносчиков вирусных инфекций на эндемичных территориях. Выявление вирусов Тамды и лихорадки долины Сырдарьи в клещах указывает на возможность их этиологической роли в возникновении лихорадочных заболеваний с неясной этиологией среди населения и подтверждает необходимость мониторинга за указанными инфекциями в регионе.

Разработанные праймеры к вирусам Карши, Тамды, Иссык-Кульской лихорадки и лихорадки долины Сырдарьи могут быть использованы в мониторинге очагов и диагностики заболеваний, проходящих с лихорадкой неясной этиологии.

Работа была проведена в рамках научной программы «Разработка научных основ единой для Республики Казахстан системы мониторинга, диагностики и микробного коллекционирования возбудителей особо опасных, «возвращающихся», вновь возникающих и завозных инфекций». Шифр программы О.0819.

 

Список литературы

  1. Benjiang M.A. Sequencing and comparative analysis of the complete glycoprotein gene of three Crimean — Congo hemorrhagic fever virus Chinese isolates / M.A. Benjiang, H. Changshou, A. Papa // Chinese J. Exp. Clin. Virol. — 2001. — Vol. 15. — P. 105–111.
  2. Львов Д.К. Новые и возвращающиеся инфекции — дремлющий вулкан / Д.К. Львов // Проблемы особо опасных инфекций. — 2008. — № 2. — С. 5, 6.
  3. Шестакова И.В. Инфекционная заболеваемость в Российской Федерации в 2000–2015 гг.: успех или провал? / И.В. Шестакова // Инфекционные болезни: Новости. Мнения. Обучение. — 2017. — № 3. — С. 20.
  4. Taylor L.H. Risk factors for human disease emergence / L.H. Taylor, S.M. Latham, M.E. Woolhouse // Philosophical Transactions of the Royal Society B: Biological Sciences. — 2001. — Vol. 356 (1411). — Р. 983–989.
  5. Jones K.E. Global trends in emerging infectious diseases / K.E. Jones, N.G. Patel, M.A. Levy, A. Storeygard, D. Balk, J.L. Git- tleman, Р. Daszak // Nature. — 2008. — Vol. 451, No. 7181. — Р. 990–993.
  6. Гражданов А.К. Природная очаговость геморрагической лихорадки с почечным синдромом на западе Казахстана / А.К. Гражданов, Ф.Г. Бидашко, М.В. Пак // Медицина. — 2002. — № 4. — С. 19–23.
  7. Ильясова И.С. Уровень и динамика заболеваемости Конго-Крымской геморрагической лихорадкой по Кызылордин- ской области в 2012 году / И.С. Ильясова, А.М. Матжанова, Л.Ж. Кульсеитова, Э.А. Кариева // Окружающая среда и здоровье населения. — 2013. — № 2Д. — С. 100.
  8. Кыраубаев К.К. О некоторых итогах эпидемиологического надзора за Конго-Крымской геморрагической лихорадкой в Южно-Казахстанской области / К.К. Кыраубаев, Ж.Б. Медетов // Окружающая среда и здоровье населения. — 2013. — № 2Д. — С. 52.
  9. Танкибаев М.А. О циркуляции некоторых арбовирусов на территории Центрального Казахстана / М.А. Танкибаев, A.A. Ким, М.С. Срымбетов, С.К. Каримов, Т.В. Кирющенко // Организация работы в диагностических центрах: тез. докл. науч. конф. — Караганда, 1993. — С. 183, 184.
  10. Альховский С.В. Таксономия вируса Иссык-Куль (Issyk-Kulvirus, iSKV; bunyaviridae, Nairovirus), возбудителя Иссык- Кульской лихорадки, изолированного от летучих мышей (Vespertilionidae) и клещей Argas (Carios) vespertilionis (Latreille, 1796) / С.В. Альховский, Д.К. Львов, М.Ю. Щелканов, А.М. Щетинин, П.Г. Дерябин, Е.И. Самохвалов, А.К. Гительман, А.Г. Ботиков // Вопросы вирусологии. — 2013. — № 5. — С. 11, 12.
  11. Львов Д.К. Генетическая характеристика вируса лихорадки долины Сырдарьи (sDVFV — Syr-Daryavalleyfevervirus) (Picornaviridae, Cardiovirus), изолированного от человека и клещей Hyalommaas. Asiaticum (Hyalomminae), Dermacentor daghe- stanicus (Rhipicephalinae) (Ixodidae) и Ornithodoro sconiceps (Argasidae) в Казахстане и Туркмении / Д.К. Львов, С.В. Альхов- ский, М.Ю. Щелканов, А.М. Щетинин, П.Г. Дерябин, А.К. Гительман, В.А. Аристова, А.Г. Ботиков // Вопросы вирусологии. — 2014. — № 4. — С. 17–19.
  12. Kuhn J.H. Genomic Characterization of the Genus Nairovirus (Family Bunyaviridae) / J.H. Kuhn, M.R. Wiley, S.E. Rodriguez, Y. Bao, K. Prieto, A.P. Travassos da Rosa // Viruses. — 2016. — No. 8(6). — Р. 240–247.
  13. Calisher C.H. Antigenic Classification and Taxonomy of Flaviviruses (Family Flaviviridae) Emphasizing a Universal System for the Taxonomy of Viruses Causing Tick-Borne Encephalitis / C.H. Calisher // ActaVirol. — 1988. — No. 32 (5). — Р. 78–85.
  14. Turell M.J. Experimental Transmission of Karshi (Mammalian Tick-Borne Flavivirus Group) Virus by Ornithodoros Ticks >2,900 Days after Initial Virus Exposure Supports the Role of Soft Ticks as a Long-Term Maintenance Mechanism for Certain Fla- viviruses / M.J. Turell // Trop. Dis. — 2015. — No. 9 (8). — Р. 12–19.
  15. Ng W.C. The 5' and 3' Untranslated Regions of the Flaviviral Genome / W.C. Ng, R. Soto-Acosta, S.S. Bradrick, M.A. Garcia- Blanco, E.E. Ooi // Viruses. — 2017. — No. 9(6). — Р. 247–256.
  16. Kuno G. Phylogeny of the genus Flavivirus / G. Kuno, G.J. Chang, K.R. Tsuchiya, N. Karabatsos, C.B. Cropp // J. Virol. — 1998. — No. 72 (1). — Р. 73–83.
Год: 2021
Город: Караганда
Категория: Биология