Применение полимеразной цепной реакции для выявления точечной мутации у быков-производителей

Авторами статьи проведена работа по генотипированию племенных быков-производителей АО «Асыл-Тулик» и ТОО «Асыл» на наличие генетических мутации с помощью полимеразной цепной реакции в сочетании с ПДРФ анализом. По результатам исследования быки-производители являются свободными от вредных генетических мутации -  BLAD, CVM, DUMPS и Citrullinemia. 

Введение

В настоящее время описаны множество наследственных заболеваний крупного рогатого скота различных видов и пород. Быстрота и точность диагностики многих из них значительно повысились благодаря достижениям молекулярной биологии, развитию молекулярно-генетических методов регистрации полиморфных локусов ДНК и мутационных изменений, созданию эффективных ДНК-диагностических процедур для исследования человека и различных видов сельскохозяйственных животных. Анализируя мировую литературу по генетике крупного рогатого скота, следует отметить, что в последние годы получено много новых данных по генетическим дефектам у этого вида животных. Так, если сравнивать количество летальных дефектов крупного рогатого скота в списке Визнера и Виллера 1979, и Millar, 2000, то в первом из них их число равно 46, а во втором 403 [1,2].

Определение носителей мутаций играет важную роль в работе племенных хозяйств. Продажи племенных бычков невозможны без тестирования на летальные мутации. Тестирование коров и телок также необходимо для снижения затрат на осеменение и выращивание молодняка. Все наследственные заболевания крупного рогатого скота в той или иной степени связаны с нарушением репродуктивной функции у коров, снижением резистентности организма телят, у носителей мутации генетического дефекта часто регистрируются эмбриональная смертность, повышение индекса осеменения в результате ранней смертности предимплантационных эмбрионов в период беременности. Так, наследственное заболевание крупного рогатого скота, дефицит лейкоцитарной адгезии BLAD (bovineleukocyteadhesiondeficiency) сопровождается снижением иммунитета  у телят, предрасположенностью у молодняка к бактериальным инфекциям. По данным различных авторов данный генетический дефект наносит большой экономический ущерб животноводству [3].

Комплексное уродство позвоночника у крупного рогатого скота, CVM (complexvertebralmalformation) как летальная аутосомальная рецессивная наследственная болезнь  впервые была описана  в 2001 году американским ученым Agerholm J .S. [4].

DUMPS (Deficiencyofuridinemonophosphatesynthase), является смертельным наследственным аутосомно-рецессивным расстройством крупного рогатого скота, которое сопровождается эмбриональной смертностью в период имплантации в начальной    стадии стельности у коров. В клетках млекопитающих, на последней стадии, синтез пиримидиновых нуклеотидов включает конверсию оротата в уридинмонофосфатсинтетазу (UMP) и этот биохимический процесс катализируется ферментом UMP  синтетаза. Фермент UMP-синтетаза является необходимым для синтеза пиримидиновых нуклеотидов, которые входят в состав ДНК и РНК. Рост и развитие гомозиготных рецессивных предимплантационных эмбрионов заканчиваются эмбриональной смертностью, приблизительно на  40-й день после зачатия [5].

Citrullinemia - это врожденное нарушение обмена веществ из-за дефицита фермента цикла мочевины, аргининсукцинатсинтетазы (L-citrulline:L-aspartateligase). Эта болезнь была впервые описана у людей, но относительно недавно установлена у молочного скота Австралии. Обычно больные гомозиготные по гену сitrullinemia телята рождаются нормальными, но на второй и третий день они становятся вялыми, отмечаются признаки депрессии и снижается аппетит. Такие животные погибают на 7-й день после рождения с клиническими признаками коллапс, слепота и резкое ухудшение состояния больного животного. Анализ последовательности гена ASAS показал, что  нуклеотидная замена C на T является причиной точечной мутации у крупного рогатого скота. Известно, что у животных носителей мутации Citrullinemia исчезает сайт рестрикции для эндонуклеазыAva II и этот полиморфизм  используется для ПЦР диагностики [3,4,5].

В настоящее время, интенсивный обмен генетическими материалами между странами требует проведения систематического мониторинга качества биоматериалов, таких, как замороженная сперма, замороженный эмбрион и живой скот. Во всех странах с развитым животноводством большое внимание уделяется своевременной диагностике генетических дефектов у племенных животных с целью недопущения распространения гетерозиготных носителей.

В связи свышеизложенным, целью настоящей работы было проведение мониторинга племенных быков-производителей на носительство генетических мутаций BLAD, CVM, DUMPS и Citrullinemia.

Материал и методика исследований

Исследования проводились на 68 племенных быках-производителей АО «Асыл- Тулик» Акмолинской области и на 43 быках ТОО «Асыл» Алматинской области в рамках реализации проекта «Мониторинг племенных животных Республики Казахстан на носительство генетических дефектов с помощью молекулярно-генетических методов» на период 2012-2013 годы в учебно-научно-диагностической лаборатории Казахстанско- Японского инновационного центра Казахского национального аграрного университета. Породный состав исследуемой группы быков-производителей АО «Асыл-Тулик» представлен более 14 породами отечественной и зарубежной селекции, а в ТОО «Асыл» были, в основном быки, местной Алатауской породы и быки мясной породы зарубежной селекции. Анализ документов племенных животных зарубежной селекции показывает, что 38% быков-производителей были протестированы на наличие генетического дефекта методом полимеразной цепной реакции и результаты тестирования были обозначены BL, бык свободен от гена BLAD синдрома и   TV, бык свободен от гена CVM.

В качестве материала для исследования были использованы замороженные образцы спермы быков-производителей в соломинках АО «Асыл-Тулик» и пробы спермы, замороженные в виде гранул быков ТОО «Асыл». Объем замороженной  спермы в пайеттах 0,2 мл и гранул 0,5 мл. Существуют разные способы выделения ДНК из биологических материалов. На сегодня самым распространенным и простым в методическом плане остается метод выделения ДНК с помощью фенол-хлороформ- изоамилового  спирта,  который  позволяет  выделить  из  спермы  качественную  ДНК    в большом количестве и с высокой концентрацией. Однако этот метод представляет определенную опасность для здоровья исследователя и поэтому нами был использован наряду с фенол-хлороформ-изоамиловый спирт методом, метод выделения ДНК с помощью набора «ДНК сорб В».

При выделении ДНК из замороженной спермы быков-производителей по методу Bahnak центрифугировали 0,2 мл спермы в течение 5 минут при 4000 g. Осевшие клетки промывали 0,15 М раствором NaCI, 2мМ ЭДТА и центрифугировали в течение 5 минут при 4000 g. Эту процедуру повторяли дважды. Затем, после последнего центрифугирования верхний слой отсасывали с помощью пипетки, а к осадку добавляли лизирующий буфер Bahnak в количестве 1 мл, имеющий следующий состав: 6М гуанидинтиоцианат, 25 мМ цитрат натрия рН 7,0, 0,5% Sarcosyl, 0,1 М 2-меркаптоэтанол и инкубировали при 370С в течение 30 минут. Перед депротеинизациейлизированный раствор ДНК разбавляли 0,15 М раствором NaCL в соотношении 1:4. Депротеинизацию осуществляли по обычной методике, путем добавления равного объема смеси фенол- хлороформ-изоамиловый спирт (24:24:1). После центрифугирования осторожно отсасывали верхний слой пипеткой и осаждали в двух объемах 96% этилового спирта. Высушивали ДНК в течение 2-5 минут под вытяжным шкафом и растворяли в буфере ТЕ [6].

При выделении ДНК из замороженной спермы быков-производителей с помощью набора «ДНК сорб В», с целью оптимизации и выделения более качественной ДНК из спермы быков-производителей нами был использован способ предварительной обработки спермы следующим образом: вносили в пробирку 200 мкл спермы, затем добавляли 1 мл лизирующего буфера, имеющий состав 100 мМТрис, 20 мМ ЭДТА, 10 мМNaCI, рН 8,0 и перемешивали в течение 30 секунд, далее центрифугировали g10000 об/мин в течение 5 минут. После центрифугирования, суспендировали осадок в 500 мкл буфера:  100 мМТрис, 20 мМ ЭДТА, 10 мМNaCI, рН 8,0 и добавляли 8 мкл 2-меркаптоэтанола. Затем перемешивали на вортексе в течение 1 минуты и оставляли на 30 минут при комнатной температуре. Подготовленную таким способом смесь  в  количестве  100  мкл использовали для выделения ДНК с помощью набора «ДНК сорб-В»  согласно инструкции.

В первую очередь, перед выделением ДНК прогревали лизирующий раствор и раствор для отмывки №1 из набора «ДНК-сорб-В» в течение 1 часа при температуре 65 °С. Затем, внесли в пробирку 100 мкл подготовленную с меркаптоэтанолом смесь и тщательно перемешивали на вортексе и прогревали 5 минут при температуре 65 °С. Центрфугировали 5 секунд при 5000 об/мин на микроцентрифуге. В каждую пробирку, затем вносили 25 мкл универсального ресуспендированного сорбента из набора. Перемешивали на вортексе, ставили на штатив на 2 минуты, затем повторяли эту процендуру еще раз и ставили на штатив на 5 минут. Осаждали сорбент центрифугированием при 5000 об/мин в течение 30 секунд. Удаляли надосадочную жидкость, затем вносили по 300 мкл раствора для отмывки №1. Перемешивали на вортексе, осаждали сорбент центрфугированием, удаляли надосадочную жидкость. Вносили 500 мкл раствора для отмывки №2, перемешивали на вортексе, центрифугировали, удаляли надосадочную жидкость. Повторяли процедуру отмывки с использованием раствора для отмывки №2. Подсушивали сорбент универсальный после удаления надосадочной жидкости в термостате при 65 °С в течение 5-10 минут. В пробирки вносили по 50 мкл ТЕ-буфера для элюции ДНК. Перемешивали на вортексе, инкубировали в термостате при 65 °С в течение 5 минут с периодическим встряхиванием. Центрифугировали пробирки на максимальных оборотах микроцентрифуги в течение 1 минуты.  Надосадочная  жидкость  содержит  очищенную  ДНК,  которую  в   последущем использовали для полимеразной цепной реакции. Качество и количество выделенной таким способом ДНК проверяли на 0,8 % агарозном геле.

Проведение полимеразной цепной реакции для детекции точечной мутации у быков- производителей. Тестирование животных на наличие генетических дефектов, в первую очередь, включает выбор праймеров для амплификации нужного фрагмента ДНК. Нами была проведена работа по подбору соответствующих пар праймеров для проведения эксперимента. Сначала с сайта NCBI вывели из базы данных полную последовательность генов BLAD, CVM, DUMPS и Citrullinemia. Для ПЦР диагностики BLAD и CVM использовали последовательности праймеров других авторов, а для выявления мутации DUMPS, Citrullinemia кроме праймеров известных авторов, был произведен дизайн собственных праймеров с помощью программы Primer 3. При разработке праймеров мы учитывали размер амплифицируемого фрагмента, для хорошей визуализации при агарозном электрофорезе и размеры фрагментов после рестрикции соответствующей эндонуклеазой,  оптимальной длины для определения носителей мутации.

Полимеразную цепную реакцию проводили на термоциклере «Терцик» производства России, который имеет четыре блока по 10 ячеек в каждом блоке. Для выявления полиморфизма гена CD 18 мы использовали следущиепраймеры: прямой праймер 5′- AGGCAGTTGCGTTCAATGTGA - 3′ и обратный праймер 5′- CCGACTCGGTGA TGCCATTGA - 3′. Специфические праймеры были синтезированы лабораторией AppliedBiosystems. Использование данной пары праймеров позволяет амплифицировать 159 пар нуклеотидов фрагмента гена CD 18.

Условия проведения полимеразной цепной реакции: первый шаг - денатурация ДНК при температуре 94 °С – 5 минут, второй шаг – денатурация при 94 °С – 45 сек, отжиг праймеров – 62 °С 45 сек и элонгация при температуре 72 °С 45 сек. Завершающий синтез при 72 °С с продолжительностью 2 мин. Хранение при +4 °С. Объем реакционной смеси был 50 мкл, имеющий следующий состав: 5 мкл 10 Х буфера для ПЦР, 1,5 мМ MgCl2, 2,5 мкл 25 мкМ прямого и обратного праймеров, 5 мкл 0,2 мМ концентрации каждого dNTP, 0,5 мкл фермента TaqPolymerase с активностью 5u/μl, 5 мкл ДНК и 26,5 мкл дистиллированной воды.

   

Рисунок 1. Электрофореграммаамплификата гена CD 18, длина амплификата 159 п.н.

Готовили обычно реакционную смесь на 10 реакций и внесли в каждую пробирку готовую ПЦР реакционную смесь в количестве 18,5 мкл и добавляли в каждый образец по 5 мкл ДНК и нанесли по 2 капли минерального масла. Для проведения полимеразной цепной реакции использовали тонкостенную пробирку Эппедорфа объемом 0,5 мл.

Продолжительность амплификации составила 35-40 циклов, после окончания амплификации готовили 3% агарозу и заливали гель. В каждую лунку агарозного геля внесли по 7 мкламплификата, а в первую лунку в качестве ДНК маркера, pUC19DNA рестрицированная рестриктазойMspI. Данный маркер имеет, фрагменты длиной 501,489, 404, 331, 242, 190, 147, 111, 110, 67, 34, 34 пар нуклеотидов. Продукт амплификации подвергали электрофорезу при режиме: напряжение 180 В, сила тока 150 мА, мощность 50 Вт и продолжительность 45-60 минут. В случае успешной амплификации, на электрофореграмме хорошо виден бэнд размером 159 п.н. (рисунок 1). Визуализацию результатов амплификации и продукта рестрикции осуществляли с помощью гель- документирующей системы. Результаты электрофореза документировали в виде электронного варианта и распечатали электрофореграммы. У здоровых животных появляется сайт рестрикции для рестриктазыTaq I и амплификат после рестрикции дает два фрагмента размером 110 и 49 пар нуклеотидов (рисунок 2).

 Электрофореграмма продуктов рестрикции амплификата гена CD 18 эндонуклеазой Taq I, длина фрагментов  49 и 110 п.н.

ДНК, выделенная из замороженной спермы быков былаамплифицирована для ПЦР диагностики DUMPS и Citrullinemia в течение 40-45 циклов. Продукт амплификации проверяли в 3%-ной агарозе. Для выявления носителей мутации DUMPS ставили рестрикцию амплификата с рестриктазойAva I, а для детекции носителей CitrullinemiaрестриктазойAva II. После рестрикции ставили горизонтальный электрофорез в 3%-ной агарозе и результаты электрофореза зафиксировали с помощью гель-документирующей системы. В таблице 1 показаны основные параметры амплификатов и продуктов рестрикции при генотипировании быков-производителей на - BLAD, CVM, DUMPS и Citrullinemia.

Результаты исследований и их обсуждение

В результате проведенных экспериментов в течение 2012-2013 гг было протестировано всего быков-производителей АО «Асыл-Тулик» 68 голов и ТОО   «Асыл»

43 головы на наличие генетических мутаций BLAD и CVM, 54 головы быков- производителей АО «Асыл-Тулик» на генетические дефекты DUMPS, Citrullinemia.

Важным   этапом    настоящей    работы  была      оптимизация   условий   проведения полимеразной цепной реакции и способов выделения ДНК из спермы. Экпериментальным путем были установлены оптимальный состав ПЦР буфера и необходимая концентрация MgCl2 для ПЦР диагностики BLAD. Успешно амплификация прошла при концентрации 1,5 мМ MgCl2, оптимальным был состав буфера 100 мМTris-HCI (рН 8,8), 500 мМ KCI. При   повышении   концентрации   MgCl2     до   3-4   мМ   отмечается   неспецифическая амплификация, а при снижении концентрации MgCl2 наблюдается очень низкий сигнал. При       проведении             ПДРФ-ПЦР            анализа           большое     значение           имеет           качество используемой ДНК. Опыт работы показывает, что выход пригодной для амплификации ДНК обеспечивает выделение ДНК по методу Bahnak, где предусмотрено использование фенол-хлороформ-изоамилового спирта. Применение способа выделения ДНК с помощью набора  «ДНК  сорб  В»  позволяет  генотипировать  племенных  животных  методом  ПЦР анализа, однако выход ДНК относительно низкий и составляет 60-70 %.

По результатам исследования 68 животных АО «Асыл-Тулик» и 43 головы ТОО «Асыл» имеют нормальный генотип по исследуемым локусам, BLAD и CVM. Отсутствие носителей генетических дефектов у племенных быков-производителей можно объяснить тем, что основная часть исследуемых животных, были местной Алатауской, Аулиекольской, Казахской белоголовой, Аулиеатинской пород, которые в своей родословной не имеют предков, носителей мутации. Быков-производителей зарубежной селекции проверены всего 52 головы, из них 27 животные были тестированы на наличие генетических дефектов BLAD и CVM. В настоящее время методом полимеразной реакции было проверено 54 головы на наличие точечной мутации DUMPS, Citrullinemia и результаты были отрицательные.

Выводы

Результаты исследований позволяют утверждать, что для мониторинга племенных животных наиболее доступным и точным способом является – метод  полимеразной цепной реакции в сочетании с ПДРФ анализом. Установлено, что племенные быки- производители АО «Асыл-Тулик» и ТОО «Асыл» являются свободными от вредных генетических мутаций,  BLAD, CVM, DUMPS и Citrullinemia.

 

Литература 

  1. Яковлев А.Ф., Прохоренко П.Н. Cовременные тенденции использования генетики в животноводстве // Вестник РАСХН. № 2. С. 56–59.
  2. Марзанов Н.С., Ескин Г.В., Турбина И.С., Девришев Д.А., Тохов М.Х., Марзанова С.Н. Генодиагностика и распространение аллеля иммунодефицита, или BLAD синдрома, у черно-пестрой породы крупного рогатого скота. Москва
  3. Meydan H, Mehmet Y, Agerholm J Screening for bovine leukocyte adhesion deficiency, deficiency of uridine monophosphate synthase, complex vertebral malformation, bovine citrullinaemia, and factor XI deficiency in Holstein cows reared in Turkey ActaVeterinariaScandinavica 2010, 52:56
  4. Agerholm JS: Inherited disorders in Danish cattle. APMIS 2007, 122 (Suppl).
  5. Schwenger B, Tammen I, Aurich C: Detection of homozygous recessive genotype for deficiency of uridine monophosphate synthase by DNA typing among bovine embryos produced in vitro. J ReprodFertil 1994, 100:511-514.
  6. Bahnak B.R. A single and efficient vethod for isjlating high molecular weight DNA from mammalian sperm.// NAR. -1988
  7. Grupe S, Diet G, Schwerin M: Population survey of citrullinemia on German livestockProdSci 1996, 45:35-38.
Год: 2013
Город: Алматы